RegulonDB RegulonDB 10.9: Gene Sequence
yqfE gene sequence


Size: 231        A: 41  T: 63  G: 74  C: 53

Fasta

 

>yqfE E. coli K12. Version NC_000913.3 GI:556503834
atgcatttcgctcagcgagttcgcgccctggttgtgttgaatggcgtggcgttattgcct
caatttgcctgtaaacaggggcttgcgaacggtgaactggtgcgcctgtttgcaccgtgg
agcggcatacccagaccgttgtatgctttatttgcggggcgaaaggggatgcctgccatt
gcgcgatattttatggatgagttaaccacgcggcttgccaacggggtctga
              
                            

Download fasta file
RegulonDB