RegulonDB RegulonDB 10.10: Gene Sequence
mltC gene sequence


Size: 1080        A: 274  T: 254  G: 270  C: 282

Fasta

 

>mltC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaatatctcgcgctggctttgattgcgccgttgctcatctcctgttcgacgacc
aaaaaaggcgatacctataacgaagcctgggtcaaagataccaacggttttgatattctg
atggggcaatttgcccacaatattgagaacatctggggcttcaaagaggtggtgatcgct
ggtcctaaggactacgtgaaatacaccgatcaatatcagacccgcagccacatcaacttc
gatgacggtacgattactatcgaaaccatcgccgggacagaacctgccgcgcatttgcgc
cgggcaattatcaaaacgttattgatgggtgacgatccgagttcggtcgatctctattcc
gacgttgatgatattacgatttcgaaagaacctttcctttacggtcaggtggtggacaac
accgggcagccgattcgctgggaaggtcgcgcaagcaacttcgcggattatctgctgaaa
aaccgtctgaagagccgcagcaacgggctgcgtatcatctacagcgtcaccattaacatg
gtgccgaaccaccttgataaacgtgcgcacaaatatctcggcatggtccgccaggcgtca
cggaaatatggcgttgatgagtcgctgattctggcaattatgcagaccgaatcttccttt
aacccgtatgcggtcagccgttccgatgcgctgggattaatgcaggtggtacaacatact
gccgggaaagatgtgttccgctcgcaggggaaatccggcacgccgagccgcagtttcttg
tttgatcctgccagcaatattgataccggcaccgcgtatctggcgatgctgaacaatgtt
tatctcggcggaattgataacccaacatcgcggcgttatgccgtcatcaccgcctataac
ggcggcgcaggcagcgtgctgcgagtcttttcgaatgataagattcaggctgccaatatt
attaacaccatgacgccgggcgatgtttatcagacgctgacgacccgccatccctctgcg
gaatctcgccgttatctttataaagtgaataccgcgcaaaaatcctaccgccgccgataa
              
                            

Download fasta file
RegulonDB