RegulonDB RegulonDB 10.9: Gene Sequence
hybO gene sequence


Size: 1119        A: 263  T: 248  G: 313  C: 295

Fasta

 

>hybO E. coli K12. Version NC_000913.3 GI:556503834
atgactggagataacaccctcatccattctcacggcattaaccgtcgtgatttcatgaag
ctttgtgcagcattagccgccaccatggggttaagtagcaaagccgctgcagagatggcc
gaatcggttactaacccgcagcgtccgccagttatctggattggcgcgcaggagtgcacc
ggttgtacggaatctctgcttcgtgcaacgcatccaacggtagaaaacctcgtactggag
actatctctctggagtatcacgaagtgctttccgccgccttcggtcatcaggtcgaagag
aacaaacataacgctctcgagaagtacaaagggcagtatgtgttagtggtggatggttcc
atcccattaaaagataacggtatttattgcatggttgccggtgagccgattgtggatcac
atccgcaaagcggcggaaggcgcagcagccattatcgctatcggttcctgctctgcgtgg
ggcggtgttgccgcagctggagttaacccaactggcgcagtcagcctgcaagaagttctg
ccaggcaaaaccgttatcaatattccgggctgcccgccgaacccgcacaacttcctcgcg
accgttgcgcacatcatcacttacggcaaaccgccgaaactggatgacaaaaaccgtccg
accttcgcctatggccgtctgattcacgaacactgcgaacgtcgcccgcacttcgatgct
ggtcgttttgccaaagagttcggtgatgaaggccaccgcgaaggctggtgcctgtaccac
ctcggctgtaaagggccagaaacttacggcaactgctcaacgctgcaattctgcgatgtt
ggcggtgtgtggccggtggcgattggtcacccttgctatggctgtaacgaagaaggtatc
ggcttccataaaggcatccatcagcttgccaacgtcgaaaatcaaactccgcgttcacag
aaaccggatgttaacgctaaagagggcggcaacgtctctgcaggcgctattggtttgctc
ggcggtgtggttgggttggttgccggtgtcagcgtgatggcggtgcgtgaactgggtcgt
cagcaaaagaaagataacgctgactcacggggagaataa
              
                            

Download fasta file
RegulonDB