RegulonDB RegulonDB 10.10: Gene Sequence
yqhC gene sequence


Size: 957        A: 244  T: 230  G: 265  C: 218

Fasta

 

>yqhC E. coli K12. Version NC_000913.3 GI:556503834
atgctacaaaattgcgcacaatcaaattgccgcattattcctaagaaattacgcgatatg
aaacgtgaagagatttgccgcttgctggcggataaagttaataaactgaaaaataaagaa
aatagtttgtcaggactgttgcccgatgtgcgtttgttgtatggcgagacgcctttcgca
cgtacaccggtgatgtacgagcctggcatcataattctcttttccgggcataaaatcggt
tatatcaatgaacgcgtgtttcgttatgatgccaatgaatacctgctgctgacggtgccg
ttgccgtttgagtgcgaaacctatgccacgtcagaggtgccgctggcagggttgcgtctc
aatgtcgatattttgcagttacaggaactgttgatggacattggcgaagatgagcatttc
cagccgtcgatggcagccagcgggattaactccgccacgttatcagaagagattttatgc
gcggcggagcggttactcgacgtgatggagcgaccactggatgcgcgtattctcggcaaa
cagatcatccgcgaaattctgtactacgtgctgaccggaccttgcggcggcgcgttactg
gcgctggtcagtcgccagactcacttcagtctgattagccgcgtgctgaaacggattgag
aataaatacaccgaaaacctgagcgtcgagcaactggcggcagaagccaacatgagcgta
tcggcgttccaccataattttaagtctgtcaccagtacctcgccgttgcagtatttgaag
aattaccgtctgcataaggcgcggatgatgatcatccatgacggcatgaaggccagcgca
gcagcgatgcgcgtcggctatgaaagcgcatcgcaatttagccgtgagtttaaacgttac
ttcggtgtgacgccgggggaagatgcggcaagaatgcgggcgatgcaggggaattaa
              
                            

Download fasta file
RegulonDB