RegulonDB RegulonDB 11.0: Gene Sequence
ygiZ gene sequence


Size: 333        A: 84  T: 135  G: 70  C: 44

Fasta

 

>ygiZ E. coli K12. Version NC_000913.3 GI:556503834
atgttaaagcagaaaattaaaacaatatttgaagcattgctatatataatgcttacttat
tggttaatagattctttttttgctttcaataagtatgactggatgcttgagtcgggagga
aatatttgcagtataccttccgtttcaggcgaagatcgtatattgcaagcaatgattgca
gcattttttcttcttacgccacttattattcttatcttaagaaaactctttatgcgggaa
atgttcgagttttgggtatatgtattctcgctcggtatttgtctggtttgtggttggtgg
cttttttggggacggtttatattttgctattag
              
                            

Download fasta file
RegulonDB