RegulonDB RegulonDB 10.10: Gene Sequence
yqiB gene sequence


Size: 423        A: 112  T: 107  G: 106  C: 98

Fasta

 

>yqiB E. coli K12. Version NC_000913.3 GI:556503834
atgaagcgttacacacctgactttcctgaaatgatgcgcctgtgcgagatgaacttttca
caattgcgccgtttgttaccgcgcaatgacgcacccggcgaaactgtaagctatcaggtg
gcaaacgcacaatatcggctgacgattgtggaatcgacccgatacactaccctggtgaca
atagaacagactgcgcccgcgatcagttactggagccttccgtcaatgacggtgcgtctg
tatcatgacgcgatggtggctgaagtgtgttcaagccagcagatttttcgcttcaaagcg
cggtatgattatcctaataaaaagttgcatcaacgcgacgaaaagcatcaaattaatcag
tttttagcggactggttgcgatactgtttagcacatggagcgatggcgattccggtttat
tag
              
                            

Download fasta file
RegulonDB