RegulonDB RegulonDB 10.10: Gene Sequence
higB gene sequence


Size: 315        A: 107  T: 87  G: 68  C: 53

Fasta

 

>higB E. coli K12. Version NC_000913.3 GI:556503834
atgcacctgataactcaaaaagcattgaaagatgctgcggaaaaatacccgcaacataaa
acggagttggtggctctggggaacacgattgctaagggatatttcaaaaaacctgagtca
ttaaaagcagtattcccatctctggataacttcaaatatctggataagcattatgttttc
aatgttgggggcaatgaattacgtgttgtagcaatggtcttttttgaatcgcaaaagtgc
tacatacgtgaagttatgacgcataaagaatacgatttctttaccgctgttcatcgtact
aaggggaaaaaatga
              
                            

Download fasta file
RegulonDB