RegulonDB RegulonDB 10.9: Gene Sequence
yqjA gene sequence


Size: 663        A: 132  T: 195  G: 182  C: 154

Fasta

 

>yqjA E. coli K12. Version NC_000913.3 GI:556503834
atggaacttttgacccaattgctgcaagccctgtgggcgcaggattttgaaaccctggcc
aatccatcgatgattggcatgttgtattttgtcttgtttgtaattttgttccttgaaaac
ggcttgcttccggcggcctttttaccgggcgacagtttactggtattggtcggcgtgttg
attgcgaaaggcgcgatgggctatccgcaaacgattctgctgctgaccgttgccgccagc
ctcggctgctgggtcagctatattcaggggcgatggctgggcaatacccgcaccgtacaa
aactggctatctcatttacccgcgcattatcatcaacgcgcacaccatctttttcataaa
cacggtttatcggcgctgttaattggtcgctttattgcgtttgtcagaacactgctgccg
acgattgccgggttatcagggctgaataacgcgcgctttcagtttttcaactggatgagc
ggtctgctgtgggtattgatcctgacaactctgggttacatgctcggcaaaacgccggta
tttttaaagtacgaggaccagctgatgtcatgcctgatgctgctcccggtggtgctgctg
gtgtttggcctggcaggttctctggtcgtgttatggaaaaagaaatatggaaatcggggg
taa
              
                            

Download fasta file
RegulonDB