RegulonDB RegulonDB 11.1: Gene Sequence
yqjK gene sequence


Size: 300        A: 65  T: 65  G: 93  C: 77

Fasta

 

>yqjK E. coli K12. Version NC_000913.3 GI:556503834
gtgagcagtaaagtcgaacgtgaacgacgtaaggcgcaactgcttagccagatccagcaa
caacggctggatctttccgccagtcgtcgtgaatggctggagacaacaggcgcttacgat
cgtcgctggaatatgctgctaagtctgcgctcctgggcgctggttggcagtagcgtgatg
gcgatctggacgattcgccatcctaatatgctggtccgctgggccagacgcggttttggc
gtatggagcgcctggcgtctggttaaaacgaccctcaagcagcaacagcttcgcggttaa
              
                            

Download fasta file
RegulonDB