RegulonDB RegulonDB 10.10: Gene Sequence
tdcE gene sequence


Size: 2295        A: 567  T: 509  G: 614  C: 605

Fasta

 

>tdcE E. coli K12. Version NC_000913.3 GI:556503834
atgaaggtagatattgataccagcgataagctgtacgccgacgcatggcttggctttaaa
ggtacggactggaaaaacgaaattaatgtccgcgattttattcaacataactatacaccg
tatgaaggcgatgaatctttcctcgccgaagcgacgcctgccaccacggaattgtgggaa
aaagtaatggaaggcatccgtatcgaaaatgcaacccacgcgccggttgatttcgatacc
aatattgccaccacaattaccgctcatgatgcgggatatattaaccagccgctggaaaaa
attgttggcctgcaaacggatgcgccgttgaaacgtgcgctacacccgttcggtggcatt
aatatgattaaaagttcattccacgcctatggccgagaaatggacagtgaatttgaatat
ctgtttaccgatctgcgtaaaacccataaccagggcgtatttgatgtttactcaccggat
atgctgcgctgccgtaaatctggcgtgctgaccggtttaccagatggctatggccgtggg
cgcattatcggtgactatcgccgcgtagcgctgtatggcatcagttatctggtacgtgaa
cgcgaactgcaatttgccgatctccagtctcgtctggaaaaaggcgaggatctggaagcc
accatccgtctgcgtgaggagctggcagagcatcgtcatgcgctgttgcagattcaggaa
atggcggcgaaatatggctttgatatctctcgcccggcgcagaatgcgcaggaagcggtg
cagtggctctacttcgcttatctggcggcagtgaaatcgcaaaatggcggcgcgatgtcg
ctgggccgcacggcatcgttcctcgatatctacattgagcgcgactttaaagctggcgta
ctcaatgagcagcaggcacaggaactgatcgatcacttcatcatgaagatccgtatggta
cgcttcctgcgtacaccggaatttgattcgctgttctccggcgacccaatctgggcgacg
gaagtgatcggcgggatggggctggacggtcgtacgctggtgaccaaaaactccttccgc
tatttgcacaccctgcacactatggggccggcaccggaacctaacctgaccattctttgg
tcggaagaattaccgattgccttcaaaaaatatgccgcgcaggtgtcgatcgtcacctct
tccttgcagtatgaaaatgacgatctgatgcgtactgacttcaacagcgacgattacgcg
attgcctgctgcgtcagcccaatggtgattggtaagcaaatgcagttctttggtgcacgc
gctaacctggcgaaaacgctgctctacgcaattaacggcggggtggacgagaagctgaag
attcaggtcgggccgaaaacagcaccgctgatggacgacgtgctggattacgacaaagtg
atggacagcctcgatcacttcatggactggctggcggtgcagtacatcagcgcgctgaat
atcattcactacatgcacgacaagtacagctacgaagcttcgctgatggcgctgcacgat
cgtgatgtctatcgcactatggcatgcggcatcgcgggcctgtcggtggcgacggactcc
ctgtctgccatcaaatatgcccgcgtgaaaccaatccgtgacgaaaacggcctggcggtg
gactttgaaatcgacggtgaatatccgcagtacggcaacaacgacgagcgcgtagacagc
attgcctgcgacctggttgaacgctttatgaagaaaattaaagcgctgccaacctatcgc
aacgccgtccctacccagtcgattctgactatcacttctaacgtggtgtacggccagaaa
accggtaatacgccggacggtcgtcgcgccggaacaccgttcgcgccgggcgctaacccg
atgcatggtcgtgaccgcaaaggtgccgtggcctcattgacgtcggtggcgaaactgccg
ttcacctacgccaaagatgggatctcgtacaccttctcaatcgttcctgcggcgctgggc
aaagaagatccagtacgtaaaaccaaccttgtcggcctgctggatgggtatttccaccac
gaagcggatgtcgaaggcggtcaacacctcaacgtcaacgtaatgaatcgggaaatgctg
ctggatgccatcgagcacccggaaaaatatcctaacctgacaatccgtgtctctggctac
gccgtgcgcttcaacgcactgacccgtgaacagcaacaggatgttatttcacgtaccttt
acccaggcgctctga
              
                            

Download fasta file
RegulonDB