RegulonDB RegulonDB 10.9: Gene Sequence
yhbO gene sequence


Size: 519        A: 137  T: 121  G: 142  C: 119

Fasta

 

>yhbO E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagaaaattgccgttttaatcactgatgaatttgaggattcagaatttacttca
cccgcagacgagttccgtaaagccggacacgaagtgattaccattgaaaaacaagcgggt
aaaacggtgaaaggcaaaaaaggagaagccagcgtgaccatcgataaatccatcgatgaa
gtgacgcctgcggagtttgatgccctgctgctaccgggcggccattcaccggattatctg
cgtggggacaaccgttttgtcacctttacccgtgattttgtgaatagtggcaaaccggtg
tttgccatctgtcacggcccgcagttgctgatcagcgccgatgtgattcgggggcgcaaa
ctgaccgcagttaaaccgatcattattgatgttaaaaatgcgggcgcggaattttacgat
caggaagtcgtggttgataaagatcagctggttaccagccggacaccggacgatctgcca
gcgtttaaccgcgaggcgttacgcctgctcggtgcctga
              
                            

Download fasta file
RegulonDB