RegulonDB RegulonDB 10.9: Gene Sequence
ubiT gene sequence


Size: 525        A: 123  T: 130  G: 158  C: 114

Fasta

 

>yhbT E. coli K12. Version NC_000913.3 GI:556503834
gtgttggataaactgcgttcccgtattgtgcatttggggccatctctgttgagtgtaccg
gtaaaactgacgccatttgcgctaaaacgccaggttcttgagcaggtcttaagctggcaa
ttccgccaggcgctggatgatggcgagctggagtttcttgaaggccgctggttaagtatt
catgtgcgtgatattgacctgcaatggtttacctcggtggtgaatggcaaactggtcgtt
agccagaacgcgcaagctgatgtgagttttagtgccgacgccagcgatctgctgatgatt
gcggcgcgtaaacaagatccggatacgctcttcttccagcgtcggctggtgattgaaggc
gatacggagctggggctgtatgtgaaaaacctgatggacgccattgaactggagcaaatg
ccgaaagccttacgcatgatgctgctgcaactggcggattttgttgaggcgggaatgaaa
accgcgcctgaaaccaaacagacatcggtaggtgaaccatgctaa
              
                            

Download fasta file
RegulonDB