RegulonDB RegulonDB 10.9: Gene Sequence
ubiU gene sequence


Size: 996        A: 214  T: 216  G: 291  C: 275

Fasta

 

>ubiU E. coli K12. Version NC_000913.3 GI:556503834
atggagctgctctgccctgccggaaatctcccggcgcttaaggcggccatcgaaaacggc
gcagatgctgtttatatcgggctaaaagatgataccaatgcccgtcacttcgccggcctt
aactttaccgagaaaaaattgcaggaagcggtgagttttgtccatcaacatcgccgcaaa
cttcacatcgcgattaacacttttgcgcatccggacggttacgcccgttggcagcgcgcc
gtggatatggcggcgcagctgggtgccgacgcgctgatcctcgccgacctcgccatgctg
gagtacgccgccgagcgttatccgcatattgagcgccacgtatcggtgcaggcttcggcg
accaatgaagaggcgattaacttttatcatcgccattttgacgttgctcgcgtggtgctg
ccgcgcgtgttgtcgattcatcaggtgaaacaactggcacgggtcacacctgtaccactg
gaagtctttgctttcggcagcctgtgcattatgtcggaaggtcgttgctatctgtcgtcg
tatctgacgggtgagtcgcccaacaccataggcgcgtgttctccggcccgtttcgtgcgc
tggcaacaaacgccgcaggggctggaatcccgcctgaacgaagtgctgatcgaccgttat
caggacggcgaaaacgcaggttatccgacgctatgtaaagggcgttatctggtggacggc
gagcgctatcacgcgctggaagaaccaaccagtctcaataccctggaactgctgccggag
ttaatggcggcgaatattgcttcggtgaaaattgaaggccgccagcgtagcccggcgtat
gtcagccaggtggcgaaagtctggcgtcaggctatcgaccgttgtaaggccgatccgcaa
aactttgtaccgcaaagcgcgtggatggagacgctcgggtcgatgtccgaaggcacgcaa
accactcttggcgcatatcaccgtaaatggcagtga
              
                            

Download fasta file
RegulonDB