RegulonDB RegulonDB 10.9: Gene Sequence
obgE gene sequence


Size: 1173        A: 295  T: 254  G: 373  C: 251

Fasta

 

>obgE E. coli K12. Version NC_000913.3 GI:556503834
atgaagtttgttgatgaagcatcgattctggtcgttgcaggtgatggcggtaatggttgc
gtgagcttccgccgcgaaaagtatattccgaaaggcggcccggatggcggcgacggcggt
gatggtggtgacgtatggatggaagccgacgagaacctgaacacgcttatcgattatcgt
tttgaaaaatctttccgtgcagagcgcggtcagaatggcgcaagccgcgactgtaccggt
aagcgcggtaaagacgtgacgattaaagtgccggtaggtacgcgtgtaatcgaccagggt
actggtgaaaccatgggcgatatgaccaaacacggtcagcgtctgctggttgctaagggc
ggctggcacggtctgggcaatacccgtttcaaatcgtccgttaaccgtacaccgcggcag
aaaaccaacggcacgccgggcgataagcgcgagctgctgctggagctgatgctgctggct
gacgtcggtatgttggggatgccaaacgcgggtaaatcgacctttattcgtgcggtatcg
gcggctaaaccgaaagtggcggattatccgtttaccactctggtgccaagtctgggtgtg
gtacgaatggacaacgaaaagagcttcgttgttgccgatattccaggactgattgaaggc
gctgcggaaggcgcaggtctgggcattcgcttcctgaagcacctggaacgttgccgcgtc
ctgttgcacctcatcgatatcgatccgattgacggcaccgatccggttgaaaacgcgcgt
attattatcagcgagctggaaaaatacagccaggatctggcgacgaaaccgcgttggtta
gtgttcaacaagatcgatctgctggataaggtagaagccgaagagaaagcgaaagcgatc
gctgaggcgctgggctgggaagataaatattatctgatctctgcggcgagtggactgggc
gtgaaagatctctgctgggatgtgatgacctttatcattgaaaacccggtcgtgcaggct
gaagaagcgaaacagccagagaaagtcgaattcatgtgggatgattatcatcgccagcag
cttgaagagattgctgaagaggatgatgaagactgggatgacgactgggacgaagacgac
gaagaaggcgttgagttcatttacaagcgttaa
              
                            

Download fasta file
RegulonDB