RegulonDB RegulonDB 10.10: Gene Sequence
ibaG gene sequence


Size: 255        A: 62  T: 64  G: 73  C: 56

Fasta

 

>ibaG E. coli K12. Version NC_000913.3 GI:556503834
atggaaaataatgaaattcagagcgtgttgatgaacgctctctccctccaggaagtccac
gtttccggcgatggcagccactttcaggttattgccgtgggtgagttgtttgacggcatg
agtcgggttaaaaaacagcagacggtctatggtccgctgatggaatatattgcggataac
cgcattcatgctgtgtcgatcaaagcgtatacccctgcggagtgggcgcgcgatcgcaaa
ctgaacggcttttga
              
                            

Download fasta file
RegulonDB