RegulonDB RegulonDB 10.10: Gene Sequence
mlaB gene sequence


Size: 294        A: 67  T: 70  G: 93  C: 64

Fasta

 

>mlaB E. coli K12. Version NC_000913.3 GI:556503834
atgagcgagtcactgagctggatgcagacgggtgacacgctggcgttatccggagagctg
gatcaggacgttttgctaccgctttgggaaatgcgtgaggaagcggtgaaggggattacc
tgcatcgatcttagccgtgtctcccgcgtggatacggggggactggcactgctgctccat
cttatcgatctggcgaaaaagcagggcaacaatgtgacgcttcagggggtaaacgacaaa
gtgtataccctggcgaaattgtataatttgcctgctgatgttctgcctcgttaa
              
                            

Download fasta file
RegulonDB