RegulonDB RegulonDB 10.10: Gene Sequence
kdsC gene sequence


Size: 567        A: 133  T: 136  G: 167  C: 131

Fasta

 

>kdsC E. coli K12. Version NC_000913.3 GI:556503834
atgagcaaagcaggtgcgtcgcttgcgacctgttacggccctgtcagcgccgacgttata
gcaaaagcagagaacattcgtctgctgatcctcgatgtcgatggcgtactgtcagatggc
ctgatttatatgggcaataatggcgaagagctgaaagcgttcaatgttcgtgacggttat
ggcattcgttgtgcgctcacctctgatattgaagtcgctatcattaccgggcgaaaggct
aaactggtagaagatcgttgtgccacattggggatcactcacttgtatcaggggcagtca
aacaaactgatcgcctttagcgatctgctggaaaaactggcgattgccccggaaaatgtg
gcttatgtcggcgatgatctcatcgactggccggtaatggaaaaagtgggtttaagcgtc
gccgtggccgatgcgcatccactgttgatcccgcgcgccgattacgtgacgcgcattgct
ggcggtcgtggcgcagtgcgcgaagtttgcgacttattactcctggcgcagggcaaactg
gatgaagccaaagggcaatcgatatga
              
                            

Download fasta file
RegulonDB