RegulonDB RegulonDB 10.9: Gene Sequence
yrbL gene sequence


Size: 633        A: 163  T: 146  G: 169  C: 155

Fasta

 

>yrbL E. coli K12. Version NC_000913.3 GI:556503834
atgattcgcttatctgaacaaagtcccctgggcaccggaagacatcggaaatgttatgcg
catccggaagatgcccaacgctgtatcaagattgtctaccatcgtggcgatggtggcgat
aaagagatccgccgtgagttaaagtactacgcgcatcttggtcgccggttaaaagactgg
agtggaataccgcgctatcacggtaccgttgagacggattgcggaaccggttatgtctac
gatgtgattgcagattttgacggcaagccttccattacgctgaccgaatttgctgaacaa
tgccgttacgaagaagacattgcacaactgcgccagctactgaaacagctgaagcgttat
ttgcaggataaccgtatcgtgacgatgtcgctgaagccgcagaatatcctctgtcaccgc
atcagtgagtcagaggttatcccggtcgtctgcgacaacattggtgaaagcacattgatt
ccactggcgacctggtcgaagtggtgttgtctgcgtaagcaagagcggttatggaaacga
tttatcgcccaaccggcgctggctattgccctgcagaaagatctgcaacctcgtgagagc
aaaacgctggccctcacttcgcgcgaagcttaa
              
                            

Download fasta file
RegulonDB