RegulonDB RegulonDB 10.9: Gene Sequence
mtgA gene sequence


Size: 729        A: 158  T: 192  G: 208  C: 171

Fasta

 

>mtgA E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaaagccgcttaacggtgtttagtttcgttcgccgttttcttttgcggttaatg
gttgtcctcgccgttttctggggcgggggcatcgcgttgtttagcgttgcgcctgttccc
ttctcagcggtaatggtcgagcgacaggtcagcgcctggctgcatggcaattttcgttac
gtggcacattctgactgggtcagtatggatcaaatctcgccgtggatgggactggcggtg
attgccgcagaagatcagaaatttcctgagcactggggctttgatgtcgcttccattgag
aaagccctggcgcacaacgagcgcaatgaaaaccgtattcgcggtgcttcaacgatttct
caacagacagccaaaaatctctttttatgggatgggcgtagctgggttcgaaaagggctg
gaagccggattaacgctggggatagaaacggtctggagcaaaaagcgtatcctgacggtt
tacctgaatatcgccgaatttggcgacggtgtgtttggcgtcgaagctgcggcacaacgt
tatttccacaaacccgcgagcaaacttacccggtcggaagctgcattactggcagctgta
ttacctaatccacttcgtttcaaagtctcctcgccatcgggctacgtgcgtagccgtcag
gcgtggattttacggcagatgtatcagttaggcggtgagccgtttatgcaacaacaccag
ctggattaa
              
                            

Download fasta file
RegulonDB