RegulonDB RegulonDB 10.9: Gene Sequence
yhcH gene sequence


Size: 465        A: 131  T: 114  G: 126  C: 94

Fasta

 

>yhcH E. coli K12. Version NC_000913.3 GI:556503834
atgatgatgggtgaagtacagtcattaccgtctgctgggttacatcctgcgttacaggac
gcgttaacgctggcattagctgccagaccgcaagaaaaagcgccgggtcgttacgaatta
cagggcgacaatatctttatgaatgtcatgacgtttaacactcaatcgcccgtcgagaaa
aaagcggaattgcacgagcaatacattgatatccagctgttattaaacggtgaggaacgg
attctgtttggcatggcaggcactgcgcgtcagtgtgaagagttccaccatgaggatgat
tatcagctttgcagcaccattgataacgagcaagccatcatcttaaaaccgggaatgttc
gccgtgtttatgccaggtgaaccgcataaaccaggatgcgttgtcggcgagcctggagag
attaaaaaggttgtggtgaaggttaaggctgatttaatggcttaa
              
                            

Download fasta file
RegulonDB