RegulonDB RegulonDB 10.8: Gene Sequence
nanK gene sequence


Size: 876        A: 169  T: 195  G: 277  C: 235

Fasta

 

>nanK E. coli K12. Version NC_000913.3 GI:556503834
atgaccacactggcgattgatatcggcggtactaaacttgccgccgcgctgattggcgct
gacgggcagatccgcgatcgtcgtgaacttcctacgccagccagccagacaccagaagcc
ttgcgtgatgccttatccgcattagtctctccgttgcaagctcatgcgcagcgggttgcc
atcgcttcgaccgggataatccgtgacggcagcttgctggcgcttaatccgcataatctt
ggtggattgctacactttccgttagtcaaaacgctggaacaacttaccaatttgccgacc
attgccattaacgacgcgcaggccgcagcatgggcggagtttcaggcgctggatggcgat
ataaccgatatggtctttatcaccgtttccaccggcgttggcggcggtgtagtgagcggc
tgcaaactgcttaccggccctggcggtctggcggggcatatcgggcatacgcttgccgat
ccacacggcccagtctgcggctgtggacgcacaggttgcgtggaagcgattgcttctggt
cgcggcattgcagcggcagcgcagggggagttggctggcgcggatgcgaaaactattttc
acgcgcgccgggcagggtgacgagcaggcgcagcagctgattcaccgctccgcacgtacg
cttgcaaggctgatcgctgatattaaagccacaactgattgccagtgcgtggtggtcggt
ggcagcgttggtctggcagaagggtatctggcgctggtggaaacgtatctggcgcaggag
ccagcggcatttcatgttgatttactggcggcgcattaccgccatgatgcaggtttactt
ggggctgcgctgttggcccagggagaaaaattatga
              
                            

Download fasta file
RegulonDB