RegulonDB RegulonDB 10.8: Gene Sequence
nanE gene sequence


Size: 690        A: 149  T: 139  G: 216  C: 186

Fasta

 

>nanE E. coli K12. Version NC_000913.3 GI:556503834
atgtcgttacttgcacaactggatcaaaaaatcgctgctaacggtggcctgattgtctcc
tgccagccggttccggacagcccgctcgataaacccgaaatcgtcgccgccatggcatta
gcggcagaacaggcgggcgcggttgccattcgcattgaaggtgtggcaaatctgcaagcc
acgcgtgcggtggtgagcgtgccgattattggaattgtgaaacgcgatctggaggattct
ccggtacgcatcacggcctatattgaagatgttgatgcgctggcgcaggcgggcgcggac
attatcgccattgacggcaccgaccgcccgcgtccggtgcctgttgaaacgctgctggca
cgtattcaccatcacggtttactggcgatgaccgactgctcaacgccggaagacggcctg
gcatgccaaaagctgggagccgaaattattggcactacgctttctggctataccacgcct
gaaacgccagaagagccggatctggcgctggtgaaaacgttgagcgacgccggatgtcgg
gtgattgccgaagggcgttacaacacgcctgctcaggcggcggatgcgatgcgccacggc
gcgtgggcggtgacggtcggttctgcaatcacgcgtcttgagcacatttgtcagtggtac
aacacagcgatgaaaaaggcggtgctatga
              
                            

Download fasta file
RegulonDB