RegulonDB RegulonDB 10.9: Gene Sequence
yhdT gene sequence


Size: 243        A: 38  T: 73  G: 73  C: 59

Fasta

 

>yhdT E. coli K12. Version NC_000913.3 GI:556503834
atggacactcgttttgttcaggcccataaagaggcgcgctgggcgctggggctgaccctt
ttgtatctggcagtttggttagtagccgcttacttatctggcgttgcccccggttttacc
ggctttccgcgctggtttgagatggcctgcatcctgacgccgctgctgtttattggactg
tgctgggcgatggtgaaatttatctatcgcgatatcccactggaggatgacgatgcagct
tga
              
                            

Download fasta file
RegulonDB