RegulonDB RegulonDB 10.10: Gene Sequence
yhdV gene sequence


Size: 222        A: 47  T: 55  G: 66  C: 54

Fasta

 

>yhdV E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagattaattcctgtggcattgctcaccgcattgctggcgggctgtgctcacgat
tcgccctgcgttccggtttatgacgatcagggtcgtctggttcacaccaatacctgtatg
aaaggcacgactcaggataactgggaaacggctggggctattgccggcggggcagctgct
gttgctggcctgacgatggggatcatcgctctatcgaaataa
              
                            

Download fasta file
RegulonDB