RegulonDB RegulonDB 10.9: Gene Sequence
yrdA gene sequence


Size: 555        A: 140  T: 144  G: 153  C: 118

Fasta

 

>yrdA E. coli K12. Version NC_000913.3 GI:556503834
atgtctgatgttttacgcccataccgcgatctttttccacaaatcggtcagcgcgtaatg
atcgacgatagcagtgtcgtgattggtgacgttcgtctggctgatgatgtggggatctgg
ccgctcgttgtgattcgtggagatgtacattatgtacagatcggagcacgcaccaatatc
caggatggcagtatgttgcatgtcactcataaatcctcgtacaacccagatggcaaccca
ttaaccattggcgaagatgtcactgttggtcacaaggtgatgctccacggctgcaccatt
ggcaatcgagttttggttgggatgggctcaattttacttgatggcgcaatagtagaagat
gatgtgatgattggtgcgggtagtctggtcccacaaaataaacggctggagagcggatat
ctgtatctcggtagccccgtcaaacagatccgcccgttaagtgatgaagagaaggctggg
ttacgctattccgcgaataattacgtgaaatggaaggacgaatatctggatcagggtaac
cagacccagccttga
              
                            

Download fasta file
RegulonDB