RegulonDB RegulonDB 10.9: Gene Sequence
gspA gene sequence


Size: 1470        A: 382  T: 368  G: 404  C: 316

Fasta

 

>gspA E. coli K12. Version NC_000913.3 GI:556503834
atgtctacgagaagagaagttattctttcctggttgtgtgagaaacgtcaaacctggcgt
ctatgctatttgttgggtgaggctggaagtggaaaaacctggctggcgcagcaactgcaa
aaagataaacatcgccgtgtgattactttaagcctcgttgtttcctggcaaggtaaggcc
gcatggatcgttaccgacgataacgcggctgaacagggctgccgtgacagcgcctggacg
cgagatgagatggcggggcaattactgcatgcgcttcatcgaactgatagtcgctgccct
cttattattattgaaaatgctcacctgaatcaccgccgcatacttgatgatctccaacgc
gcaatatctcttattcctgacggtcaatttttgctgatcggcagacccgatcgaaaagtc
gaacgtgattttaaaaaacagggcattgaacttgtctcgataggacgtctgacggagcac
gaacttaaggcaagcatccttgaaggtcagaatattgaccaacccgatctccttttaacc
gccagagttctgaaacggatagctttattatgtcggggcgatcgcagaaagctggcgctt
gccggcgaaacaattcgcttattacagcaagccgagcagaccagcgttttcacagcaaaa
caatggcgaatgatttaccgcatattgggtgataaccgcccccggaaaatgcagcttgcc
gtggtgatgagtggaaccattatcgctcttacctgtggttggctactgctgtcctctttt
acagctacgttacccgttcctgcgtggctgatacccgtaacgccagtagttaaacaagat
atgactaaggatattgctcatgtggtgatgcgcgatagtgaggcgctaagcgtgttatac
ggcgtatgggggtacgaggtcccagctgattcggcctggtgcgatcaggcagtaagagcg
gggctggcatgtaaaagtgggaatgcttctttacaaacattggtagatcagaatttgccc
tggatcgcatcgcttaaagtcggggacaaaaaattgcctgttgtggtcgttcgcgtcggt
gaggctagcgttgatgtcctcgtaggtcagcaaacgtggacgctgacacataaatggttt
gagtcggtatggacgggtgattatcttctgttgtggaaaatgtcgccggaaggggagagt
accattacgcgtgatagcagcgaggaagagattctctggctggaaacgatgttaaaccgc
gcattgcatatttcgacagaaccttcggcggagtggcgtcccttgttggtagaaaaaata
aagcaatttcaaaaaagccaccacttgaaaactgacggtgttgttggcttttcaacgtta
gtacatctctggcaggtggcaggggagagtgcctacttatatcgggatgaagcaaatatt
tccccggaaacaacagtgaaggggaaatga
              
                            

Download fasta file
RegulonDB