RegulonDB RegulonDB 10.9: Gene Sequence
gspH gene sequence


Size: 510        A: 113  T: 111  G: 139  C: 147

Fasta

 

>gspH E. coli K12. Version NC_000913.3 GI:556503834
atgaatcagcaacgcgggtttaccctgctggagatgatgctggtgctggcgctggtcgct
atcacggcaagcgtggtgctcttcacatatggccgggaggatgtcgccagcactcgtgcg
cgcgaaacagcggcgcggtttaccgctgcacttgaattagccatcgaccgcgccacgctc
agtggtcagcctgtcggtatccatttctctgattcagcatggcgcattatggtaccgggc
aaaacaccatcagcctggcgctgggttccattacaagaagatgccgcagacgagagccaa
aatgactgggatgaagaactctcaattcatcttcagccatttaaacctgatgacagcaac
cagccacaggttgtgattctggccgacggacaaatcacgcccttctctttgttgatggct
aacgccgggaccggtgagccgctcctgacgttagtctgttcaggctcatggcccctggat
caaacgctcgccagagatacccgcccatga
              
                            

Download fasta file
RegulonDB