RegulonDB RegulonDB 10.9: Gene Sequence
fkpA gene sequence


Size: 813        A: 251  T: 170  G: 211  C: 181

Fasta

 

>fkpA E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcactgtttaaagtaacgctgctggcgaccacaatggccgttgccctgcatgca
ccaatcacttttgctgctgaagctgcaaaacctgctacagctgctgacagcaaagcagcg
ttcaaaaatgacgatcagaaatcagcttatgcactgggtgcctcgctgggtcgttacatg
gaaaactctctaaaagaacaagaaaaactgggcatcaaactggataaagatcagctgatc
gctggtgttcaggatgcatttgctgataagagcaaactctccgaccaagagatcgaacag
actctacaagcattcgaagctcgcgtgaagtcttctgctcaggcgaagatggaaaaagac
gcggctgataacgaagcaaaaggtaaagagtaccgcgagaaatttgccaaagagaaaggt
gtgaaaacctcttcaactggtctggtttatcaggtagtagaagccggtaaaggcgaagca
ccgaaagacagcgatactgttgtagtgaactacaaaggtacgctgatcgacggtaaagag
ttcgacaactcttacacccgtggtgaaccgctttctttccgtctggacggtgttatcccg
ggttggacagaaggtctgaagaacatcaagaaaggcggtaagatcaaactggttattcca
ccagaactggcttacggcaaagcgggtgttccggggatcccaccgaattctaccctggtg
tttgacgtagagctgctggatgtgaaaccagcgccgaaggctgatgcaaagccggaagct
gatgcgaaagccgcagattctgctaaaaaataa
              
                            

Download fasta file
RegulonDB