RegulonDB RegulonDB 10.10: Gene Sequence
yzgL gene sequence


Size: 282        A: 56  T: 96  G: 75  C: 55

Fasta

 

>yzgL E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaacagaaaatggattttgacctcgctggtaatgacttttttcggcatccccata
ctggcgcaatttttggcggtggttattgccatgctgggtgtcggacttgccggtattatt
gaagtttgtaatatccttatcacgccaacaatttaccttctgctcaaaatttttatgctg
gcgctgggcgcattaatgctatttttctcggggcgagtggggaacgtgcctgagttttgt
tacgttgggtatgatggcgtgggctttgcggtaattccctga
              
                            

Download fasta file
RegulonDB