RegulonDB RegulonDB 11.0: Gene Sequence
insJ gene sequence


Size: 522        A: 154  T: 127  G: 129  C: 112

Fasta

 

>insJ E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaagccaaaatacccttttgaaaagcgccttgaagtcgtgaatcactacttcaca
actgatgatggttacaggatcatctcggcacgttttggtgtcccccgaacccaggtcagg
acatgggttgccctctatgaaaaacatggagaaaaaggtttaattcccaaacctaaaggc
gttagtgctgatccagagttgcgtattaaggtcgtgaaagctgtgatcgagcagcacatg
tcccttaatcaggctgctgctcactttatgcttgctggtagtggttctgtagccaggtgg
ctgaaggtctatgaagagcgcggagaagctggtttacgcgcgctcaagattggcaccaaa
agaaacattgcaatatcagttgatccagaaaaagcggcatcagcattggagctgtcaaaa
gaccgacgcattgaggatcttgaaaggcaagttcgatttcttgaaacgcggcttatgtat
ctaaaaaagctgaaagccttagctcatcccacgaaaaagtga
              
                            

Download fasta file
RegulonDB