RegulonDB RegulonDB 10.9: Gene Sequence
insK gene sequence


Size: 852        A: 264  T: 223  G: 199  C: 166

Fasta

 

>insK E. coli K12. Version NC_000913.3 GI:556503834
gtgaaagtactcaacgagctaaggcagttttatcctcttgatgagcttctcagggctgcg
gagataccgcgcagtacgttttattatcatctaaaggctctcagcaagcctgacaagtat
gcggacgttaaaaagcgtattagtgagatttatcacgagaatagaggccgatacggatac
cgtagggtaacgctgtctcttcatcgagaagggaaacagattaaccataaagctgttcag
cgcctgatgggaaccctctcacttaaagcagcgattaaggtcaagcgataccgctcttac
agaggagaggtagggcaaaccgcccctaatgttctccaaagagatttcaaggctacgcgg
ccaaacgagaagtgggttaccgatgttactgaatttgcagtcaatgggcgcaagctgtat
ttgtctccagtaatagatctcttcaacaacgaagttatttcttacagcctttcggaaaga
ccagtgatgaacatggttgagaatatgctcgatcaggcattcaaaaagcttaatcctcac
gagcatcctgttctgcactctgaccagggatggcagtatcgtatgagaagatatcaaaat
atccttaaagaacatggtattaaacaaagcatgtccagaaaaggcaattgtctggataat
gctgtggtggagtgtttctttggaaccttaaagtcggagtgtttttatcttgatgagttc
agtaatataagcgaactgaaggatgctgttacggaatatattgaatactacaacagcaga
agaattagcctgaaattaaaaggtctgactccaattgaatatcggaatcagacctatatg
cctcgtgtttaa
              
                            

Download fasta file
RegulonDB