RegulonDB RegulonDB 10.9: Gene Sequence
yzcX gene sequence


Size: 486        A: 109  T: 135  G: 122  C: 120

Fasta

 

>yzcX E. coli K12. Version NC_000913.3 GI:556503834
atggtagccgccctgtttggttgccagccatacctggtgcagcggctcctggcggttgat
aatgattttgctgccattctcaaaggtaatggtcagtacgccgccgttgatttcgcagtc
gatatcgctgtcgccatcccagtcgtccaggcgttcttcaatggtcagccagagttgatc
agccaggcgatgaaattcactgtcgttcattgttgtatcctgtttttaagtgatggcggc
agtatagcggcatggggtcagggcttcaaagtttgcacctctgcggctgcgttccggcac
gattcatccgtcaccggaataatgatgtctctgtgtagcgaaagatttgtctcttcatta
gggcgcagttacaccacgtctttccctgtttctggtaaacattatgatcaggtttaccga
gcgagcatcctcacgctgacggaactaaaaaagacaacaaacaaaccacattgcgatagt
gcataa
              
                            

Download fasta file
RegulonDB