RegulonDB RegulonDB 10.9: Gene Sequence
cpxP gene sequence


Size: 501        A: 148  T: 102  G: 131  C: 120

Fasta

 

>cpxP E. coli K12. Version NC_000913.3 GI:556503834
atgcgcatagttaccgctgccgtcatggcctcaacgctggcagtcagttcattaagccac
gctgctgaagtcggttcaggcgataactggcatccgggtgaagaacttacgcagcgcagt
acgcagagccatatgttcgacggcataagtttaaccgaacatcagcgtcagcagatgcga
gatcttatgcaacaggcccggcacgaacagcctcctgttaatgttagcgaactggagaca
atgcatcgccttgtcaccgcagaaaattttgatgaaaacgctgtgcgcgcacaggcagaa
aaaatggcgaatgagcaaattgctcgtcaggttgagatggcaaaagtccgcaaccaaatg
tatcgcctgttaacgccggagcagcaagcggttttaaacgagaaacatcaacaacgaatg
gagcagttgcgtgacgtgacgcaatggcaaaaaagttcatcgttgaagctattgagtagt
agcaactcacgttcccagtag
              
                            

Download fasta file
RegulonDB