RegulonDB RegulonDB 10.9: Gene Sequence
dcuR gene sequence


Size: 720        A: 196  T: 169  G: 165  C: 190

Fasta

 

>dcuR E. coli K12. Version NC_000913.3 GI:556503834
atgatcaatgtattaattatcgatgacgacgcaatggtcgcggagctgaatcgccgatac
gtagcacaaatcccaggctttcaatgctgtggaacagcctcgacgctggagaaagccaaa
gagattatcttcaatagcgatacgcctatcgacctgatattgctcgatatctatatgcaa
aaagagaacgggctcgatttactgcctgtcctgcataacgcgcgttgcaaaagtgatgtg
attgtcatctcctccgcagccgatgcggcaaccattaaagattcgctgcattacggtgtc
gtggattacctgatcaaacccttccaggcttcccgctttgaagaggcgctcaccggctgg
cggcaaaagaaaatggcgctggaaaaacatcagtattatgaccaggccgagcttgatcag
ctaatccacggcagcagctccaacgaacaggatcctcgtcgcttgccaaaaggcttaacg
ccgcagacgttacgcacactgtgccagtggattgacgcgcatcaggactatgaattttca
accgacgagctagccaacgaggttaacatttcgcgtgtttcctgccgtaaatacctcatc
tggctggtcaactgccacatcttgttcaccagtatccattatggcgtcacggggcgtcca
gtttaccgttaccgtattcaggcagaacactactcactactgaaacaatattgccaataa
              
                            

Download fasta file
RegulonDB