RegulonDB RegulonDB 11.0: Gene Sequence
yjfJ gene sequence


Size: 699        A: 200  T: 140  G: 197  C: 162

Fasta

 

>yjfJ E. coli K12. Version NC_000913.3 GI:556503834
atgggaattttaaaaagtttatttacgctggggaaatcgtttatctcccaggcggaagaa
tccattgaagaaacccagggcgtgcgcatgctggaacagcatattcgtgacgctaaagct
gaactcgataaagccggaaaatctcgcgttgatctgctggcgcgggtgaaattaagtcac
gataagctgaaagatttacgtgagcgcaaagccagtctggaagcccgtgcgctggaagcg
ttaagcaagaacgttaatccgtcgttgattaacgaagttgctgaagaaatcgcgcgcctt
gagaatctcattaccgctgaagagcaagtgttgtcgaatctggaagtctcccgtgatggc
gtggaaaaagcagttacagcgacagcgcagcgtatcgctcagtttgagcagcaaatggaa
gtcgttaaagccactgaagccatgcagcgtgcacaacaggctgtaacaacctctaccgtt
ggcgcatcttccagcgtttcgacagcggcagaatccttaaaacgcctgcaaacgcgtcag
gccgaacgtcaggctcgcctggatgctgccgcacagttggagaaagtcgcagacggtcgc
gaccttgacgaaaagctggcggaagccggaattggcggtagcaataaaagtagcgcccag
gatgtattagcaagactgcaacgccaacagggcgagtaa
              
                            

Download fasta file
RegulonDB