RegulonDB RegulonDB 10.10: Gene Sequence
yjfK gene sequence


Size: 660        A: 177  T: 170  G: 171  C: 142

Fasta

 

>yjfK E. coli K12. Version NC_000913.3 GI:556503834
atgtctggttttttccagcgtctgtttggcaaggataataagccagctatcgctcgtggt
ccgctgggacttcatctcaatagtggctttacgctcgacacgttagcgtttcgtttgctg
gaagatgaattgctgattgcgctgccgggtgaggaatttacggtagccgccgtcagccac
atcgatctgggcggcggtagtcagattttccgctactacacttcaggcgatgagtttctg
caaatcaataccaccggcggcgaagatattgatgacattgatgatatcaagctctttgtc
tatgaagagagctacggtatcagtaaagagagtcactggcgcgaggcgatcaacgccaaa
gcgatgggagcaatgaccttaaactggcaggaaaaacgctggcagcgattttttaacagc
gaagaaccgggaaatatcgaacccgtctacatgctggaaaaagtagaaaatcaaaaccat
gccaaatgggaggtccataattttaccatgggctaccaacggcaagtaaccgaagatact
tacgaatatttgctgctaaatggtgaggaatcttttaacgatctcggcgagccagagtgg
ttattttcgcgcgcgttgggtgtcgatatcccgctgacatcacttcatattattggttaa
              
                            

Download fasta file
RegulonDB