RegulonDB RegulonDB 10.10: Gene Sequence
yjfL gene sequence


Size: 399        A: 96  T: 129  G: 91  C: 83

Fasta

 

>yjfL E. coli K12. Version NC_000913.3 GI:556503834
atgcatatactggattcacttcttgcctttagcgcctatttttttattggcgtggctatg
gtgattatttttctgtttatctattctaaaattacaccgcacaacgaatggcagttaatc
aaaaacaataataccgcggcgtcactggcgttcagcggtacattgttgggttacgttatc
cccttatccagtgcggcaatcaatgcggtgagtattccagactatttcgcctggggcggg
attgcactggtgattcagttactcgtttttgctggtgtcagactttatatgcccgcatta
agcgaaaaaattattaatcacaataccgcagcaggaatgtttatgggaaccgccgcgctg
gctggcggtatttttaacgcagcttgtatgacatggtaa
              
                            

Download fasta file
RegulonDB