RegulonDB RegulonDB 10.10: Gene Sequence
yjfN gene sequence


Size: 276        A: 73  T: 62  G: 74  C: 67

Fasta

 

>yjfN E. coli K12. Version NC_000913.3 GI:556503834
atgaaacaattacttgcctcaccctcgctgcaattagtgacttatcctgcgagcgccacg
gcacagtctgcagaattcgccagtgctgactgcgtgacgggcctgaatgaaataggtcag
atctcagttagcaatatttcaggggatccgcaggacgtggaacgtatcgtggcgttaaag
gccgatgaacaaggtgcgtcatggtaccgcattattaccatgtacgaagaccagcagcct
gataactggcgcgtacaggcgatactgtatgcatga
              
                            

Download fasta file
RegulonDB