RegulonDB RegulonDB 10.10: Gene Sequence
yjfZ gene sequence


Size: 795        A: 238  T: 220  G: 157  C: 180

Fasta

 

>yjfZ E. coli K12. Version NC_000913.3 GI:556503834
atgacattaccaacgactatttattcatttcctgcatatttatctcgtttttcgtccacc
gacaaaccagtaaaattaaaatttcatcaatacgcacgcgctacattactttcaaatcgt
ggaagagatcataattgcgatggcagacgtactgttgagatccacaaactagatctctca
gactggcaagcattcaataagttagcgacgaggtgtaatgcttacgatggaatcacaatg
aatggtgataattcttttggatggaaccatgaagctacattagataatattcacgcccag
aaatacaataaagcttacgcgggtgcgaggttaaccgcagaactgaaatatttattgcaa
gatgtcgaatccttcgaacccaacagtaaatacacaatacacgaagtggttttgggacct
ggttatggtactccagactataccggccaaacgataggatacgttgtaacccttcctgcc
caaatgcctaattgctggtcatctgaactaccaacaatcgatctttatatcgaccaactt
cgcactgttacaggcgtttctaatgccctcggattcatcattgctgcattgctaaacgcg
tattctgatttaccccatgatttgaaaattggtctgcgttccttatcaagttcagccgca
atctactcgggtttgggtttcgagcgagtgccgcaggagcgagacatcagttgcgctcgt
atgtatctaacgccagcaaaccatcctgacttatggacacaagagaatggtgaatggatc
tacttgcgaaactaa
              
                            

Download fasta file
RegulonDB