RegulonDB RegulonDB 10.9: Gene Sequence
ytfE gene sequence


Size: 663        A: 185  T: 126  G: 179  C: 173

Fasta

 

>ytfE E. coli K12. Version NC_000913.3 GI:556503834
atggcttatcgcgaccaacctttaggtgaactggcgctctctattcctcgcgcttcagct
ctgtttcgtaaatatgatatggattactgctgtggcggtaagcagacgctggcgcgcgcg
gcggcacgtaaagaactggatgttgaggtcattgaagctgaactggcaaagctcgctgaa
caaccgattgagaaagactggcgtagcgccccgctggcagaaatcatcgaccatatcatc
gtgcgctaccacgatcgtcaccgcgagcaactgccggagctgattctgcaagcgactaaa
gtcgagcgcgttcacgccgacaaaccgagcgtgccaaaagggctgacaaaatacctgacc
atgctgcatgaagagctttccagccacatgatgaaagaagagcagatcctcttcccgatg
atcaaacaaggcatgggcagccaggcaatggggccaatcagcgtaatggaaagcgagcac
gatgaagcgggcgaactgctggaagtgattaaacacaccaccaataacgtcacaccgccg
ccagaagcctgcaccacctggaaagcgatgtataacggcattaatgaactgattgatgac
ctgatggatcacatcagtctggaaaacaatgtactgttcccacgcgcgctggcgggtgag
tga
              
                            

Download fasta file
RegulonDB