RegulonDB RegulonDB 10.9: Gene Sequence
idnR gene sequence


Size: 999        A: 270  T: 259  G: 234  C: 236

Fasta

 

>idnR E. coli K12. Version NC_000913.3 GI:556503834
atgcgcaatcacagaatttctttacaggatatcgctacgctggctggcgtaacaaaaatg
accgtgagtcgttatatccgctcgccgaaaaaggtggcaaaggaaacaggcgagcgcatc
gccaaaattatggaagagatcaattatatccctaatcgcgctcccggcatgttgttgaat
gcacaaagttataccctcggtatcttgattccgtcatttcaaaatcaactcttcgctgac
attctcgcgggaatagaatccgtcacctctgagcataattatcagacccttattgctaat
tacaattacgatcgcgattccgaagaagagtcggtgattaacctgctctcttataacatt
gacgggattatactttcggaaaaatatcacaccatcaggacggtgaaatttctgcgttca
gccaccattccggtcgtggaattgatggatgtacagggagaacggctggatatggaggtc
ggttttgataatcggcaggccgcttttgacatggtgtgtaccatgctggagaagcgagtc
aggcacaaaattctgtatctcggttccaaagatgacacccgcgatgaacagcgttatcag
gggtattgcgatgcgatgatgctgcataatctttccccattacgcatgaatccacgcgcc
atctcatccattcatttaggaatgcagttaatgcgtgatgcccttagcgcaaacccggat
ttagacggtgtattttgcaccaatgacgatattgcgatgggtgcgcttctgctgtgccgc
gagcgaaacctcgccgtgccagaacaaatttccattgcgggttttcatgggctggagatt
ggcaggcaaatgatcccaagcctcgccagcgtaattactccccgttttgatattggtcgg
atggccgcccaaatgttgctgagcaaaattaaaaataacgatcacaaccacaacactgtt
gacctcgggtatcagatttatcacggcaacacgctttag
              
                            

Download fasta file
RegulonDB