RegulonDB RegulonDB 10.9: Gene Sequence
idnD gene sequence


Size: 1032        A: 272  T: 271  G: 272  C: 217

Fasta

 

>idnD E. coli K12. Version NC_000913.3 GI:556503834
atgcaagtgaaaacacagtcctgcgttgttgcgggcaagaaaactgttgccgttaccgag
cagacgatagattggaataataatggaacattagtacaaataacccgaggtggaatttgc
ggttccgatttacattattatcaggaaggaaaagtaggtaatttcatgataaaggcaccg
atggtgttaggtcatgaagttatcggtaaagttattcatagcgactcatcagaattacat
gaagggcaaacggtagccattaatccgtctaaaccgtgcggtcactgcaaatactgcatt
gaacataacgagaatcagtgtacagatatgcgtttttttggcagtgccatgtatttccct
catgttgatggtggttttacccgttataaaatggtcgaaacgtcgcaatgtgtcccttat
ccggccaaagctgacgaaaaggttatggcttttgccgaacctttagccgtcgcgattcat
gccgcacatcaggccggcgagttacagggcaagcgagtatttatttccggtgttggaccc
attggctgcctgattgtcagtgcagtgaaaacactgggggccgcggaaattgtctgtgct
gatgtgagtccccgttccctttcgctgggcaaagagatgggggcggatgtgctcgtaaac
ccacaaaacgacgacatggatcactggaaagcggaaaaaggctatttcgatgtcagcttt
gaagtgtccggtcatccttcatcagtgaatacctgtctggaggtcactcgtgcacgcggc
gtaatggtgcaggtaggtatgggaggcgcgatggcagaattcccaatgatgacgttgatt
ggtaaggagatttcactcagaggctctttccgttttaccagcgaatttaataccgcagtg
tcatggctggcgaatggcgttatcaatccactgcctttactgagtgctgaatatcccttc
actgacctggaagaggcgctacgtttcgccggtgataaaacccaggcagcaaaagtccag
cttgttttctaa
              
                            

Download fasta file
RegulonDB