RegulonDB RegulonDB 11.0: Gene Sequence
iraD gene sequence


Size: 393        A: 94  T: 107  G: 96  C: 96

Fasta

 

>iraD E. coli K12. Version NC_000913.3 GI:556503834
atgatgcgacaatcacttcaggctgttttacctgaaatttcaggcaataaaacgtcatcg
ctgcgtaaatcggtatgcagcgatctcctcactctttttaattctcctcattcggcatta
ccgtcattacttgtttcaggcatgcccgagtggcaagtgcataacccgagcgacaaacat
ctccagagctggtattgccgtcagctgcgttctgcactgttatttcatgagccacggatt
gcggcgttgcaggttaatttgaaagaagcgtactgccacactctggcgatcagccttgag
ataatgctgtaccacgacgatgaaccgctaacgtttgatctggtctgggataatggcggt
tggcgcagtgcgacgctggagaatgtcagctaa
              
                            

Download fasta file
RegulonDB