RegulonDB RegulonDB 11.0: Gene Sequence
hypT gene sequence


Size: 912        A: 214  T: 230  G: 230  C: 238

Fasta

 

>hypT E. coli K12. Version NC_000913.3 GI:556503834
atggatgactgtggtgcgattttgcataatattgaaaccaaatggctttatgattttctg
accctggaaaaatgccgcaatttttcccaggcggcagtcagtcgcaacgtctcgcaaccg
gcattcagccgccgcatccgtgcgctggaacaggcgattggtgttgaattgtttaaccgc
caggtaacgccgctgcaactctcagaacaagggaaaatcttccattcgcagatccgccat
ctgttgcaacagttagagagcaatctggcagagctgcgtggcggcagcgattacgcgcaa
cgaaaaatcaagatagccgctgcacactctctttccctcgggctgttaccgtccattatc
agccagatgccgccgctctttacctgggcaattgaagctattgatgtcgatgaagcggtc
gataaactgcgtgaagggcaaagtgactgtattttttcctttcacgacgaagatttgctg
gaagcgccgtttgaccacattcgcttatttgaatctcaattgttccctgtctgcgccagt
gacgaacacggagaagcactttttaacctcgcgcagccacactttccgttactgaattac
agccgcaactcctacatggggcgattgattaatcgcaccctgacgcgccacagtgagtta
agtttcagcaccttttttgtctcttcgatgagcgagcttttaaagcaggttgccctcgac
ggctgtgggattgcctggctgccggagtacgccatccaacaagaaattcgcagcgggaag
ctcgttgtactgaatcgggacgaactggtgatcccgattcaggcctatgcataccggatg
aatacccgcatgaatcccgttgccgaacgcttctggcgtgaactgcgcgagctggagatt
gtgcttagctga
              
                            

Download fasta file
RegulonDB