RegulonDB RegulonDB 11.0: Gene Sequence
yjiG gene sequence


Size: 462        A: 98  T: 118  G: 130  C: 116

Fasta

 

>yjiG E. coli K12. Version NC_000913.3 GI:556503834
atgacaactcaggtccgcaaaaacgtcatggatatgtttatcgatggcgcgcgccgtggc
tttactatcgccacgaccaacctgctgccaaacgtggtgatggcgtttgtcatcattcag
gcgctgaaaattaccggcctgctcgactgggtggggcatatctgtgaacccgtaatggcg
ctgtggggattacccggtgaagcggcaaccgtccttttagccgcattaatgagtatgggt
ggcgcagtcggtgttgccgccagtctggcaaccgctggcgcattaaccggtcacgatgtc
accgttttactgcccgcgatgtatttaatgggcaacccggtgcaaaatgtcggtcgctgc
ctggggacagccgaagtgaatgccaaatattacccgcatatcattacggtctgcgtgatt
aacgcattgctgtcgatctgggttatgcagcttattgtttaa
              
                            

Download fasta file
RegulonDB