RegulonDB RegulonDB 11.0: Gene Sequence
yjiH gene sequence


Size: 684        A: 144  T: 177  G: 187  C: 176

Fasta

 

>yjiH E. coli K12. Version NC_000913.3 GI:556503834
atgacacaacaaggggatgctgtagccggggagctggcgacagaaaaagtgggcattaaa
gggtatctggccttttttctcaccataatctttttttccggtgttttttccggaacagac
agctggtggcgcgtttttgatttttccgttctgaacggatcgtttgggcaactgcctggt
gcgaacggagccaccacctcatttcgcggcgcgggtggcgcgggggctaaagatggcttt
ctctttgcgctggagctggcaccgtcagtcattctctctctggggattatttcaattacc
gatggtcttggtggattacgcgccgcgcagcagttaatgacacctgtgctaaaaccgttg
ttgggcattccagggatctgctcgctggcgctgatcgctaacctgcaaaacaccgatgcc
gccgccggtatgaccaaagagctggcgcaggaaggtgaaattaccgaacgcgataaagtg
attttcgccgcatatcaaaccagcggtagcgccatcatcaccaactacttctcttccggc
gtcgcggtgtttgcctttctgggcacgtccgtaatcgtacctttagccgtcatcctggtg
tttaaatttgtcggagccaacattttgcgcgtctggcttaacttcgaagaacgtcgcaac
ccaacgcaaggagcgcaagcatga
              
                            

Download fasta file
RegulonDB