RegulonDB RegulonDB 11.0: Gene Sequence
yjiJ gene sequence


Size: 1179        A: 202  T: 346  G: 317  C: 314

Fasta

 

>yjiJ E. coli K12. Version NC_000913.3 GI:556503834
atgccttcgtccacgcatcccgtagaacgcttttctttcagcaccgcgcttttcgggatg
ctggttctgaccttaggtatgggtttaggccgcttcctttatacgcctatgttgcccgtc
atgatggcggaaggatcgttttcatttagccagctctcgtggattgccagcggcaactat
gcggggtatctggctggcagtctgctattttcttttggcgcatttcaccagccatcgcgc
ctgcgcccatttctgttggcttctgccctggcgagcgggttgttgatcctcgcaatggca
tggttgccgccatttattctggtgttattgattcgcgtcctggcgggtgtcgccagcgcc
ggtatgctgatttttggttcgacgctgattatgcagcacacgcgccatccttttgtgctg
gcagctttgttttctggcgttggcattggcatcgcactgggcaatgaatatgttctggca
ggcctgcattttgacctctcctcgcaaacgttatggcaaggcgccggggcgctttctggc
atgatgctgattgcacttacgcttttaatgccctcgaaaaaacacgccatcacaccaatg
ccattggcaaaaacggagcaacagataatgagctggtggttactggctattctgtacggc
ctggcgggatttggttatatcatcgtcgcgacttacctgccgctcatggcgaaagatgca
ggctcaccattgttaaccgcccatctctggacgttagtcggcttatcaattgtgcctggt
tgctttggctggctatgggcagcaaaacgttggggggctttgccctgcctgacggcgaat
ttgctggtgcaggctatctgtgtgctgcttactctcgccagcgactcgcctctcttgctt
atcatcagcagtcttggttttggcggtacctttatgggcacgacatctctggtgatgact
atcgcccgccaactgagcgtaccgggaaatctcaatcttttaggctttgtgacgctcatt
tacggcattgggcaaatcctcggcccggcgctgaccagtatgctcagcaatggaacatcg
gcgcttgccagcgccactctctgcggcgcggcggcgttgtttattgctgcgcttatcagc
acagtgcaattatttaagctacaagtggtcacttcatga
              
                            

Download fasta file
RegulonDB