RegulonDB RegulonDB 11.0: Gene Sequence
yjiK gene sequence


Size: 861        A: 255  T: 239  G: 174  C: 193

Fasta

 

>yjiK E. coli K12. Version NC_000913.3 GI:556503834
gtgacaaaaagtatttcgttaagtaaacgcatctccattattgtgattctttttgccatt
gtggcagtgtgtactttcttcgtgcaatcttgcgcccgtaaaagcaatcatgcagcatca
tttcagaattaccacgccaccattgacggcaaagaaattgcaggcataacgaataatatc
tcttcgctgacctggtcggcacaaagcaatactctttttagcactatcaacaaacctgcc
gccattgttgaaatgaccaccaatggtgattttatccgcacaattcctctggattttgtt
aaggatctcgagacgatcgaatacattggcgataatcagtttgtcattagcgatgagcgc
gattacgccatttatgtgatttcactgaccccaaactcggaagtaaaaatcctcaaaaaa
ataaaaatcccgctgcaagactccccaaccaattgcggttttgaagggttggcttattct
cgccaggatcacactttctggttttttaaagagaaaaatccgattgaggtctacaaagtt
aacgggctgttaagtagcaatgaattacacatcagcaaagacgaggcactacaacggcaa
tttactttagatgatgtgtccggcgcagaatttaaccagcaaaaaaatacgcttctggtg
ctgtctcatgaatctcgcgcactccaggaagtaaccctggttggcgaggttatcggtgaa
atgtcactaaccaaaggcagtcgaggtttgtcgcataacatcaaacaggccgaaggggtt
gcgatggatgcctctggtaatatttatatcgttagcgaaccaaatcgtttttatcgcttt
acccctcaatcatcgcattaa
              
                            

Download fasta file
RegulonDB