RegulonDB RegulonDB 11.0: Gene Sequence
yjiM gene sequence


Size: 1152        A: 273  T: 262  G: 326  C: 291

Fasta

 

>yjiM E. coli K12. Version NC_000913.3 GI:556503834
atgtcacttgtcaccgatctacccgccattttcgatcagttctctgaagctcgccagaca
ggctttctcaccgtcatggatctcaaggagcgcggcattccgctggttggcacttactgc
acctttatgccgcaagagatcccgatggcagccggtgcggttgtggtttcgctctgttcc
acctctgatgaaaccattgaagaagcggagaaagatctgccgcgcaacctctgcccgctg
attaaaagcagctacggcttcggcaaaaccgataaatgcccctacttctacttttcggat
ctggtggtcggtgaaaccacctgcgacggcaaaaagaaaatgtatgaatacatggcggag
tttaagcctgttcatgtgatgcaattgcccaacagcgttaaggacgatgcctcgcgtgcg
ttatggaaagccgagatgctgcgcttgcaaaaaacggtagaagaacgttttgggcacgag
attagcgaagatgctctgcgcgatgccattgcgctgaaaaaccgcgaacgtcgcgcactg
gctaatttttatcatcttgggcagttaaatcctccggcgcttagcggcagcgacattctg
aaagtggtttacggcgcaaccttccggttcgataaagaggcgttgatcaatgaactggat
gcaatgaccgcccgcgttcgtcagcagtgggaagaaggccagcgactggacccgcgtccg
cgcattttaatcaccggctgcccgattggcggcgcagcagaaaaagtggtgcgcgcgatt
gaagagaatggcggctgggttgtcggttatgaaaactgcaccggggcgaaagcgaccgag
caatgcgtggcagaaacgggcgatgtctacgacgcgctggcggataaatatctggcgatt
ggctgctcctgtgtttcgccgaacgatcagcgcctgaaaatgctcagccagatggtggag
gaatatcaggtcgatggcgtagttgatgtgattttgcaggcgtgccatacctacgcggtg
gaatcgctggcgattaaacgtcatgtgcgccagcagcacaacattccttatatcgctatt
gaaacagactactccacctcggatgtcgggcagctcagtacccgtgtcgcggcctttatt
gagatgctgtaa
              
                            

Download fasta file
RegulonDB