RegulonDB RegulonDB 11.1: Gene Sequence
yjiN gene sequence


Size: 1281        A: 282  T: 325  G: 359  C: 315

Fasta

 

>yjiN E. coli K12. Version NC_000913.3 GI:556503834
atgaataaactcatcgaactcagacgcgccaaaaggttggcgctctctttactgcttatc
gccgctgctacctttgtcgttacgctgtttttgccgcccaatttttgggtgagcggcgtg
aaggcgattgctgaagcggcgatggtcggcgcgctggcggactggtttgcggtggtggcg
ctgtttcgccgcgtgccgattccgatcatttctcgccatacggcgattatcccgcgtaat
aaagaccggattggcgaaaatctcggccagttcgtgcaggaaaaatttcttgatactcaa
tccctggtggcattgattcgacgccacgaaccggcgttgctgattggcaactggtttagc
cagccagaaaacgcccgccgcgttggtcagcatctgttgcagatcatgagcggttttctc
gaacttaccgatgatgcgcgtattcagcgcctgcttaagcgcgcggtccatcgggcgatt
gataaggtcgatctttccggcaccagtgcgttgatgctggagagtatgaccaaaaacgat
cgtcatcaggtgctgctggatacgctgatcgcacagttgatcgcccttctccagcgcgat
aaatcgcgcaagtttatcgcccagcaaattgttcgctggctggagagcgagcatccactg
aaagccaaaattctccccaccgaatggttgggcgaacatagcgcggagttggtttctgac
gcggtgaattctttgcttgatgatattagtcgcgatcgtgcgcatcagatccgccatgcg
tttgatcgcgccaccttcgccctgatcgacaagctgaaaaacgatccggaaatggcagcg
cgagccgatgccgtaaaaagctatctgaaagaagatgaagcttttaatcgctatctcagt
gaattgtggggggatttacgggaatggctgaaagtggatatcaacagtgaagattctcgt
gtgaaagaacgcatcgcacgagcgggtcaatggtttggcgaaacgttaattgccgatgat
gccttgcgggcgtcgttaaatggtcatcttgaacaagccgcgcaccgcgtcgcgcctgag
ttttccgcattcctgacgcgccacatcagcgatacggtaaaaagctgggatgcgcgggat
atgtcgcggcaaatagagttaaatatcggcaaagatctgcagtttattcgtgtcaacggt
acgctggttggcggttgtattgggctaattttatatttgctgtcgcagctcccggccttg
ttccccctcggcaatttttag
              
                            

Download fasta file
RegulonDB